-
PurposeCo-expresses hM4D and a green fluorescent label from a Cre-dependent virus
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 5009
- Total vector size (bp) 7295
-
Vector typeAAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsGrow at 30 degrees in 2xYT media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namehM4D-2a-GFP
-
Alt namemuscarinic receptor 4, variant
-
Alt nameGFP
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)2286
-
Entrez GeneCHRM4 (a.k.a. HM4, M4R)
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (destroyed during cloning)
- 3′ cloning site SpeI (destroyed during cloning)
- 5′ sequencing primer ctgtggctgcgtgaaagccttg
- 3′ sequencing primer CATAAAGAGACAGCAACCAGG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBryan Roth, UNC
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
These vectors are prone to recombination. This is a well known issue with these AAV vectors and is due to the inverted terminal repeats (ITRs) required for AAV production. To minimize recombination, we propagate these plasmids in NEB Stable cells. Also, to minimize recombination, cells should be cultured at 30 C.
Note that these cultures will grow slowly (20 h for minipreps). Better yields and culture times are obtained with 2xYT as the media. This is strongly recommended.
Because recombination may still happen occasionally, we do a panel of restriction digestions to assess whether the ITRs are in tact. Separate digestions with PvuII, Sma1, and SnaB1 should be performed. The expected patterns can be calculated from the attached sequence.
Please note that this plasmid has a modified Chicken beta-actin promoter.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rAAV-CAG::FLEX-rev:: hM4D-2a-GFP was a gift from Scott Sternson (Addgene plasmid # 52536 ; http://n2t.net/addgene:52536 ; RRID:Addgene_52536) -
For your References section:
Deconstruction of a neural circuit for hunger. Atasoy D, Betley JN, Su HH, Sternson SM. Nature. 2012 Aug 9;488(7410):172-7. doi: 10.1038/nature11270. 10.1038/nature11270 PubMed 22801496