-
PurposeConstruct used for viral production of virus expressing the TVA receptor, Rabies protein G and a marker protein TagBFP.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52425 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
This item is currently unavailable outside the US without additional regulatory approval.
A non-refundable shipping export licensing fee of $85 is required to cover Addgene’s additional processing costs.
Backbone
-
Vector backboneAAV2
- Backbone size w/o insert (bp) 5340
- Total vector size (bp) 8615
-
Vector typeAAV, Cre/Lox ; ; Adeno-Associated Virus
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)Stbl2
-
Growth instructionsStbl2 E coli from Invitrogen Grow at 30 degrees in 2xYT media
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameTagBFP, TVA receptor, RabiesG
- Promoter CAG
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer tcacaagcgcgtttcacctcctg
- 3′ sequencing primer gtcccgcaagccctttt (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEd Callaway
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-FLEX-rev-BFP-2a-TVA-2a-RabiesG was a gift from Scott Sternson (Addgene plasmid # 52425) -
For your References section:
Parallel, redundant circuit organization for homeostatic control of feeding behavior. Betley JN, Cao ZF, Ritola KD, Sternson SM. Cell. 2013 Dec 5;155(6):1337-50. doi: 10.1016/j.cell.2013.11.002. 10.1016/j.cell.2013.11.002 PubMed 24315102