-
PurposeBAC recombineering generated construct, used as a reporter for OCT4 expression
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52381 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneminimal Amp vector
- Backbone size w/o insert (bp) 2278
- Total vector size (bp) 21296
-
Vector typeMammalian Expression
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameGFP-2A-puro
-
SpeciesSynthetic
Cloning Information for Gene/Insert 1
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TTGTCTGTAAGCGGATGCCGG
- 3′ sequencing primer CGCCTTTGAGTGAGCTGATACC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameOCT4
-
SpeciesH. sapiens (human)
-
Insert Size (bp)16600
-
Mutationdeleted -3194 - -1768 upstream from OCT4 ATG
-
Entrez GenePOU5F1 (a.k.a. OCT3, OCT4, OTF-3, OTF3, OTF4, Oct-3, Oct-4, Oct3/4)
- Promoter OCT4
Cloning Information for Gene/Insert 2
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TCCTTCGCCTCAGTTTCTCCCC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
delta DE OCT4-GFP-2A-PURO transgenic reporter was a gift from Jacob Hanna (Addgene plasmid # 52381 ; http://n2t.net/addgene:52381 ; RRID:Addgene_52381) -
For your References section:
Derivation of novel human ground state naive pluripotent stem cells. Gafni O, Weinberger L, Mansour AA, Manor YS, Chomsky E, Ben-Yosef D, Kalma Y, Viukov S, Maza I, Zviran A, Rais Y, Shipony Z, Mukamel Z, Krupalnik V, Zerbib M, Geula S, Caspi I, Schneir D, Shwartz T, Gilad S, Amann-Zalcenstein D, Benjamin S, Amit I, Tanay A, Massarwa R, Novershtern N, Hanna JH. Nature. 2013 Dec 12;504(7479):282-6. doi: 10.1038/nature12745. Epub 2013 Oct 30. 10.1038/nature12745 PubMed 24172903