pAC-EsaR
(Plasmid
#47643)
-
Purposewt esaR gene under control of Plac in pACYC184
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47643 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepACYC184
-
Backbone manufacturerNEB
- Backbone size w/o insert (bp) 3518
- Total vector size (bp) 4652
-
Modifications to backboneThe tetracycline resistance gene in pACYC184 was removed.
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePlac-esaR-terminator
-
Insert Size (bp)1134
-
GenBank ID
- Promoter Plac
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site SalI (not destroyed)
- 5′ sequencing primer gattacgcgcagaccaaaacgatc
- 3′ sequencing primer gttgaaggctctcaagggcatcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe amplified the esaR gene from pTDM6 (Minogue, TD et al., 2002, Mol. Microbiol.).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
pAC-EsaR is an esaR expression vector. The esaR gene (750 bp, indicated as lowercase letters in the partial sequence for wt EsaR between KpnI and BamHI) is flanked by KpnI and BamHI sites.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAC-EsaR was a gift from Cynthia Collins (Addgene plasmid # 47643 ; http://n2t.net/addgene:47643 ; RRID:Addgene_47643) -
For your References section:
Directed evolution of the quorum-sensing regulator EsaR for increased signal sensitivity. Shong J, Huang YM, Bystroff C, Collins CH. ACS Chem Biol. 2013 Apr 19;8(4):789-95. doi: 10.1021/cb3006402. Epub 2013 Feb 6. 10.1021/cb3006402 PubMed 23363022
Map uploaded by the depositor.