pDN-D2irG4kwh
(Plasmid
#44723)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44723 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA4/TO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5078
- Total vector size (bp) 7446
-
Modifications to backboneCMV-2xtetO promoter replaced with pCMV-D2i promoter. Rabbit β-globin intron and WPRE inserted before and after insert, respectively.
-
Vector typeMammalian Expression, Synthetic Biology ; Expression regulator/reporter
-
Selectable markersZeocin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert namepCMV-D2i promoter
-
Alt nameModified CMV-based synthetic promoter containing two tetO2 sites
-
SpeciesSynthetic
-
Insert Size (bp)672
-
MutationInitiator motif (Inr) displaced relative to pCMV-2xtetO (returned to its natural position). Two tetO2 sites flanking Inr motif.
- Promoter pCMV-D2i
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site AflII (not destroyed)
- 5′ sequencing primer Amp-R
- 3′ sequencing primer Bglob-intron-R (TTTGCCCCCTCCATATAACA) (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameEGFP
-
Alt nameEnhanced green fluorescent protein
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)1815
-
MutationRegion around the ATG translation start codon converted to the consensus Kozak sequence; sequence optimized for mammalian codon bias
-
Tags
/ Fusion Proteins
- Rabbit β-globin intron II (N terminal on insert)
- WPRE (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer Bglob-intron-F (ctggtcatcatcctgccttt); CMV-F
- 3′ sequencing primer WPRE-R; BGH-rev (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byMammalian codon optimized variant of eGFP gene from the pIRES2-EGFP plasmid (Clontech). Rabbit β-globin intron II-containing fragment from plasmid pcDNA6/TR (Invitrogen). Fragment containing WPRE from plasmid pLVX-DD-tdTomato (Clontech). Modified CMV-based synthetic promoter pCMV-D2i synthesized de novo (Bio Basic Inc., Markham, Ontario, Canada).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDN-D2irG4kwh was a gift from Gabor Balazsi (Addgene plasmid # 44723 ; http://n2t.net/addgene:44723 ; RRID:Addgene_44723) -
For your References section:
Transferring a synthetic gene circuit from yeast to mammalian cells. Nevozhay D, Zal T, Balazsi G. Nat Commun. 2013 Feb 5;4:1451. doi: 10.1038/ncomms2471. 10.1038/ncomms2471 PubMed 23385595