-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 44275 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepN1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 3998
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTagRFP675
-
SpeciesSynthetic
-
Insert Size (bp)717
-
MutationM41Q/F80W/S143N/L147M/S158N/D159Y/N173S
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (destroyed during cloning)
- 5′ sequencing primer ggtaggcgtgtacggtgggag (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTagRFP675-N1 was a gift from Vladislav Verkhusha (Addgene plasmid # 44275 ; http://n2t.net/addgene:44275 ; RRID:Addgene_44275) -
For your References section:
Extended Stokes shift in fluorescent proteins: chromophore-protein interactions in a near-infrared TagRFP675 variant. Piatkevich KD, Malashkevich VN, Morozova KS, Nemkovich NA, Almo SC, Verkhusha VV. Sci Rep. 2013;3:1847. doi: 10.1038/srep01847. 10.1038/srep01847 PubMed 23677204