-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 37533 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClonetech
- Backbone size w/o insert (bp) 4105
- Total vector size (bp) 4825
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL10 Gold
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namecysteine-free SGFP2-N
-
Alt namecfSGFP2-N
-
SpeciesH. sapiens (human), M. musculus (mouse)
-
Insert Size (bp)720
-
MutationC48S and C70M mutations relative to SGFP2
- Promoter CMV
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer GCAGAGCTGGTTTAGTGAACCGTCAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
cfSGFP2-N was a gift from Ikuo Wada (Addgene plasmid # 37533 ; http://n2t.net/addgene:37533 ; RRID:Addgene_37533) -
For your References section:
Development of cysteine-free fluorescent proteins for the oxidative environment. Suzuki T, Arai S, Takeuchi M, Sakurai C, Ebana H, Higashi T, Hashimoto H, Hatsuzawa K, Wada I. PLoS One. 2012;7(5):e37551. Epub 2012 May 23. 10.1371/journal.pone.0037551 PubMed 22649538