-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 32001 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-N1
-
Backbone manufacturerClontech
-
Modifications to backboneThe EGFP coding region from the EGFP-N1 vector was replaced with a PCR product containing the SEpHluorin coding region flanked by BamHI and NotI restriction sites.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namemCherry
-
Insert Size (bp)902
-
Tag
/ Fusion Protein
- Superecliptic pHluorin (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5'd[CGTCGCCGTCCAGCTCGACCAG]3' (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
mCherry-SEpHluorin was a gift from Sergio Grinstein (Addgene plasmid # 32001 ; http://n2t.net/addgene:32001 ; RRID:Addgene_32001) -
For your References section:
Amiloride inhibits macropinocytosis by lowering submembranous pH and preventing Rac1 and Cdc42 signaling. Koivusalo M, Welch C, Hayashi H, Scott CC, Kim M, Alexander T, Touret N, Hahn KM, Grinstein S. J Cell Biol. 2010 Feb 22;188(4):547-63. Epub 2010 Feb 15. 10.1083/jcb.200908086 PubMed 20156964