-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 31932 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEGFP-C1
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 4008
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namePAmCherry2
-
Alt namephotoactivatable dark-to-red mCherry red fluorescent protein
-
Insert Size (bp)708
-
MutationM18L/K69N/L84F/A147T/S148L/I165L/Q167A/L169T/A179T/I203R/R226L compared to mCherry (but numbering relative to EGFP).
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site BsrGI (unknown if destroyed)
- 5′ sequencing primer cggtaggcgtgtacggtgggag (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPAmCherry2-C1 was a gift from Vladislav Verkhusha (Addgene plasmid # 31932 ; http://n2t.net/addgene:31932 ; RRID:Addgene_31932) -
For your References section:
Photoactivatable mCherry for high-resolution two-color fluorescence microscopy. Subach FV, Patterson GH, Manley S, Gillette JM, Lippincott-Schwartz J, Verkhusha VV. Nat Methods. 2009 Feb;6(2):153-9. Epub 2009 Jan 25. 10.1038/nmeth.1298 PubMed 19169259