pCDNA3.1-spikeRBD::∆ACE2 SURF
(Plasmid
#206957)
-
PurposeFluorescent reporter of the interaction between SARS-CoV-2 spike and human ACE2
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 206957 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 5406
- Total vector size (bp) 9828
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namesars GU280_gp02, spike glycoprotein
-
SpeciesSARS-CoV-2
-
Insert Size (bp)669
-
MutationRBD (319-541)
-
Entrez GeneS (a.k.a. GU280_gp02, spike glycoprotein)
- Promoter CMV
-
Tags
/ Fusion Proteins
- cSURF (C terminal on insert)
- mCherry (C terminal on insert)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer TAATACGACTCACTATAGGG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameACE2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1796
-
Mutation17-615
-
Entrez GeneACE2 (a.k.a. ACEH)
-
Tags
/ Fusion Proteins
- nSURF (N terminal on insert)
- mCherry (N terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (unknown if destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GCTCAGTCCACCATTGAGGAACA
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCDNA3.1-spikeRBD::∆ACE2 SURF was a gift from Xiaokun Shu (Addgene plasmid # 206957 ; http://n2t.net/addgene:206957 ; RRID:Addgene_206957) -
For your References section:
Fluorogenic reporter enables identification of compounds that inhibit SARS-CoV-2. Yang J, Xiao Y, Lidsky PV, Wu CT, Bonser LR, Peng S, Garcia-Knight MA, Tassetto M, Chung CI, Li X, Nakayama T, Lee IT, Nayak JV, Ghias K, Hargett KL, Shoichet BK, Erle DJ, Jackson PK, Andino R, Shu X. Nat Microbiol. 2023 Jan;8(1):121-134. doi: 10.1038/s41564-022-01288-5. Epub 2023 Jan 5. 10.1038/s41564-022-01288-5 PubMed 36604514