pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2
(Plasmid
#199486)
-
PurposeSite directed zebrafish mutagenesis. sgRNA GAAGATCGGCCACTACATTC
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 199486 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC57
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGal4vp16/4xnrUAS-mTagBFP2
-
SpeciesSynthetic
Cloning Information
- Cloning method Unknown
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSA_2_T2A-Gal4vp16_synCoTC_4xnrUAS-mTagBFP2 was a gift from Robert Bryson-Richardson (Addgene plasmid # 199486 ; http://n2t.net/addgene:199486 ; RRID:Addgene_199486) -
For your References section:
CRIMP: A CRISPR/Cas9 Insertional Mutagenesis Protocol and the CRIMP Toolkit. Miles LB, Calcinotto V, Sonntag C, Lee C, Bryson-Richardson RJ. bioRxiv 2023 10.1101/2023.07.13.548929