pAAV-GFAP-JEDI-2P-WPRE
(Plasmid
#179469)
-
PurposeGenetically encoded voltage indicator (GEVI) JEDI-2P in AAV production vector for astrocytes specific expression using the promoter GFAP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179469 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-GFAP
- Backbone size w/o insert (bp) 4758
- Total vector size (bp) 6034
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameJEDI-2P
-
Alt nameJEDI2P
-
SpeciesSynthetic
-
Insert Size (bp)1287
- Promoter GFAP
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer ccttcataaagccctcgcatc
- 3′ sequencing primer caaaggcattaaagcagcgtatc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-GFAP-JEDI-2P-WPRE was a gift from Francois St-Pierre (Addgene plasmid # 179469 ; http://n2t.net/addgene:179469 ; RRID:Addgene_179469) -
For your References section:
Sustained deep-tissue voltage recording using a fast indicator evolved for two-photon microscopy. Liu Z, Lu X, Villette V, Gou Y, Colbert KL, Lai S, Guan S, Land MA, Lee J, Assefa T, Zollinger DR, Korympidou MM, Vlasits AL, Pang MM, Su S, Cai C, Froudarakis E, Zhou N, Patel SS, Smith CL, Ayon A, Bizouard P, Bradley J, Franke K, Clandinin TR, Giovannucci A, Tolias AS, Reimer J, Dieudonne S, St-Pierre F. Cell. 2022 Aug 16. pii: S0092-8674(22)00916-3. doi: 10.1016/j.cell.2022.07.013. 10.1016/j.cell.2022.07.013 PubMed 35985322