AAV-CAG-jGCaMP8m-WPRE
(Plasmid
#179255)
-
PurposeAAV-mediated expression of GCaMP8m under the CAG promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 179255 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
AAV1 | 179255-AAV1 | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 | ||
AAV9 | 179255-AAV9 | Virus (100 µL at titer ≥ 1×10¹³ vg/mL) and Plasmid. | $405 | ||
AAV Retrograde | 179255-AAVrg | Virus (100 µL at titer ≥ 7×10¹² vg/mL) and Plasmid. | $405 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namejGCaMP8m
-
SpeciesSynthetic
-
Insert Size (bp)1269
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCTGGTTATTGTGCTGTC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Information for AAV1 (Catalog # 179255-AAV1) ( Back to top)
Purpose
Ready-to-use AAV1 particles produced from AAV-CAG-jGCaMP8m-WPRE (#179255). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8m-WPRE plasmid DNA.
CAG-driven expression of calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV1 cap gene
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV1
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV9 (Catalog # 179255-AAV9) ( Back to top)
Purpose
Ready-to-use AAV9 particles produced from AAV-CAG-jGCaMP8m-WPRE (#179255). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8m-WPRE plasmid DNA.
CAG-driven expression of calcium sensor GCaMP8m. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 1×10¹³ vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV9 cap gene
- Buffer PBS + 0.001% Pluronic F-68
- Serotype AAV9
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Information for AAV Retrograde (Catalog # 179255-AAVrg) ( Back to top)
Purpose
Ready-to-use AAV Retrograde particles produced from AAV-CAG-jGCaMP8m-WPRE (#179255). In addition to the viral particles, you will also receive purified AAV-CAG-jGCaMP8m-WPRE plasmid DNA.
CAG-driven expression of calcium sensor GCaMP8m. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.Delivery
- Volume 100 µL
- Titer ≥ 7×10¹² vg/mL
- Pricing $375 USD for preparation of 100 µL virus + $30 USD for plasmid.
- Storage Store at -80℃. Thaw just before use and keep on ice.
- Shipment Viral particles are shipped frozen on dry ice. Plasmid DNA (≥ 200ng) will also be included in the shipment.
Viral Production & Use
- Packaging Plasmids encode adenoviral helper sequences and AAV rep gene, AAV retrograde cap gene from rAAV2-retro helper (plasmid #81070)
- Buffer PBS + 0.001% Pluronic F-68 + 200 mM NaCl
- Serotype AAV retrograde (AAVrg)
- Purification Iodixanol gradient ultracentrifugation
Biosafety
Requestor is responsible for compliance with their institution's biosafety regulations. Lentivirus is generally considered BSL-2. AAV is generally considered BSL-1, but may require BSL-2 handling depending on the insert. Biosafety Guide
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Viral Quality Control
- Addgene ensures high quality viral vectors by optimizing and standardizing production protocols and performing rigorous quality control (QC) (see a list of our QC assays). The specific QC assays performed varies for each viral lot. To learn which specific QC assays were performed on your lot, please contact us.
- Titer: the exact titer of your sample will be reported on the tube. The titer you see listed on this page is the guaranteed minimum titer. See how titers are measured.
Visit our viral production page for more information.
Addgene Comments
Retrograde functionality is dependent on high viral titers. Addgene recommends not diluting your AAV preps prior to use.These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-CAG-jGCaMP8m-WPRE was a gift from Loren Looger (Addgene plasmid # 179255 ; http://n2t.net/addgene:179255 ; RRID:Addgene_179255) For viral preps, please replace (Addgene plasmid # 179255) in the above sentence with: (Addgene viral prep # 179255-AAV1), (Addgene viral prep # 179255-AAV9), or (Addgene viral prep # 179255-AAVrg)