pHN873
(Plasmid
#178829)
-
PurposeBacterial expression for human Saposin A
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 178829 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET15b
-
Backbone manufacturerNovagen
- Total vector size (bp) 7102
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameartificial gene encoding human Saposin A
-
Alt namehSapA_60-140
-
SpeciesH. sapiens (human)
-
Insert Size (bp)294
-
MutationCodon-usage was optimized for bacterial expression. N terminal propeptide (59aa) was deleted.
-
Entrez GeneAR (a.k.a. AIS, AR8, DHTR, HUMARA, HYSP1, KD, NR3C4, SBMA, SMAX1, TFM)
- Promoter T7
-
Tag
/ Fusion Protein
- MBP, His8, TEV (N terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GATGAAGCCCTGAAAGACGCGC
- 3′ sequencing primer CTTTCAGCAAAAAACCCCTCAAGAC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pHN873 was a gift from Kazuhiro Abe (Addgene plasmid # 178829 ; http://n2t.net/addgene:178829 ; RRID:Addgene_178829)