pAN7.1
(Plasmid
#168129)
-
PurposeExpresses hygR from the gdpA promoter with a trpC terminator. Typically used in Aspergillus species as a selection marker for resistance to hygromycin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 168129 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2648
- Total vector size (bp) 6749
-
Vector typeSynthetic Biology
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHygR gene
-
Alt nameHph
-
SpeciesSynthetic; Aspergillus fumigatus
-
Insert Size (bp)4101
- Promoter gdpA
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer CAGGAAACAGCTATGACCATG
- 3′ sequencing primer ACTGGCCGTCGTTTTACA (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byPeter Punt and Arthur Ram, obtained with permission from their original work in 1987.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAN7.1 was a gift from Michael Bromley (Addgene plasmid # 168129 ; http://n2t.net/addgene:168129 ; RRID:Addgene_168129) -
For your References section:
High-Throughput Gene Replacement in Aspergillus fumigatus. Zhao C, Fraczek MG, Dineen L, Lebedinec R, Macheleidt J, Heinekamp T, Delneri D, Bowyer P, Brakhage AA, Bromley M. Curr Protoc Microbiol. 2019 Sep;54(1):e88. doi: 10.1002/cpmc.88. 10.1002/cpmc.88 PubMed 31518064