-
PurposeExpresses nanobody H11-H4, which binds to the receptor binding domain (RBD) of the spike protein of SARS-Cov-2
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 155364 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 * |
* Login to view industry pricing.
Backbone
-
Vector backbonepOPINO
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsPlease use WK6 bacterial strain for expression: 37 C, with induction of protein expression by 1mM IPTG at OD ~ 1.2, and then grown overnight at 20 C
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameH11-H4
-
SpeciesSynthetic
- Promoter T7
-
Tag
/ Fusion Protein
- His6 (C terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GTGGGTATTTGTGAGCCAG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pOPINO_NbH11-H4 was a gift from Ray Owens (Addgene plasmid # 155364 ; http://n2t.net/addgene:155364 ; RRID:Addgene_155364) -
For your References section:
Neutralizing nanobodies bind SARS-CoV-2 spike RBD and block interaction with ACE2. Huo J, Le Bas A, Ruza RR, Duyvesteyn HME, Mikolajek H, Malinauskas T, Tan TK, Rijal P, Dumoux M, Ward PN, Ren J, Zhou D, Harrison PJ, Weckener M, Clare DK, Vogirala VK, Radecke J, Moynie L, Zhao Y, Gilbert-Jaramillo J, Knight ML, Tree JA, Buttigieg KR, Coombes N, Elmore MJ, Carroll MW, Carrique L, Shah PNM, James W, Townsend AR, Stuart DI, Owens RJ, Naismith JH. Nat Struct Mol Biol. 2020 Jul 13. pii: 10.1038/s41594-020-0469-6. doi: 10.1038/s41594-020-0469-6. 10.1038/s41594-020-0469-6 PubMed 32661423