pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA
(Plasmid
#154869)
-
PurposeHuman synapsin-1 promoter; Flp-dependent rM3D(Gs) DREADD-mCherry
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 154869 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV-hSyn-Flp-WPRE
-
Backbone manufacturerGether lab - modified from Addgene plasmid #55641
- Backbone size w/o insert (bp) 4824
- Total vector size (bp) 6792
-
Vector typeMammalian Expression, AAV ; FLP-FRT
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namerM3D(Gs)-mCherry
-
Alt nameGs-DREADD
-
Insert Size (bp)1968
- Promoter Human Synapsin-1
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Asc1 (not destroyed)
- 3′ cloning site Nhe1 (not destroyed)
- 5′ sequencing primer actcagcgctgcctcagtct
- 3′ sequencing primer gatacaaaggcattaaagcagcg (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe insert is derived from Addgene #50458 and the backbone is modified (Ef1a promoter replaced with human synapsin promoter Addgene # Plasmid #55641).
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-hSyn-fDIO-rM3D(Gs)-mCherry-WPREpA was a gift from Ulrik Gether (Addgene plasmid # 154869 ; http://n2t.net/addgene:154869 ; RRID:Addgene_154869)