-
PurposepET His6 MBP TEV CbAgo
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET (Plasmid #29656)
-
Backbone manufacturerScott Gradia
- Backbone size w/o insert (bp) 6472
- Total vector size (bp) 8716
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCbAgo
-
SpeciesClostridium butyricum
-
Insert Size (bp)2244
- Promoter T7
-
Tag
/ Fusion Protein
- MPB (N terminal on insert)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer TAATACGACTCACTATAGGG
- 3′ sequencing primer GCTAGTTATTGCTCAGCGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJH-MBP-CbAgo was a gift from John van der Oost (Addgene plasmid # 127707 ; http://n2t.net/addgene:127707 ; RRID:Addgene_127707) -
For your References section:
DNA-guided DNA cleavage at moderate temperatures by Clostridium butyricum Argonaute. Hegge JW, Swarts DC, Chandradoss SD, Cui TJ, Kneppers J, Jinek M, Joo C, van der Oost J. Nucleic Acids Res. 2019 May 9. pii: 5487266. doi: 10.1093/nar/gkz306. 10.1093/nar/gkz306 PubMed 31069393