pLKO.1REST_sh_seq2_WPRE
(Plasmid
#127574)
-
PurposeshRNA to knock down RE1-silencing transcription factor (REST)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 127574 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
- Total vector size (bp) 7069
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA for knock down of REST
-
SpeciesH. sapiens (human)
-
Entrez GeneREST (a.k.a. DFNA27, GINGF5, HGF5, NRSF, WT6, XBR)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer tttcccatgattccttcata (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1REST_sh_seq2_WPRE was a gift from Malin Parmar (Addgene plasmid # 127574 ; http://n2t.net/addgene:127574 ; RRID:Addgene_127574) -
For your References section:
REST suppression mediates neural conversion of adult human fibroblasts via microRNA-dependent and -independent pathways. Drouin-Ouellet J, Lau S, Brattas PL, Rylander Ottosson D, Pircs K, Grassi DA, Collins LM, Vuono R, Andersson Sjoland A, Westergren-Thorsson G, Graff C, Minthon L, Toresson H, Barker RA, Jakobsson J, Parmar M. EMBO Mol Med. 2017 Aug;9(8):1117-1131. doi: 10.15252/emmm.201607471. 10.15252/emmm.201607471 PubMed 28646119