OA984
(Plasmid
#120363)
-
PurposeExpresses an single chain antibody 1C19 that targets all four DENV serotypes and expresses a red fluorescent protein reporter
-
Depositing Lab
-
Sequence Information
-
Sequences (1) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 120363 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBac[3xP3-DsRed]
- Total vector size (bp) 9310
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert name1C19 single chain antibody
-
Insert Size (bp)717
- Promoter AAEL010782 carboxypeptidase A (CPA) gene Promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GGGTTGAGTTTTAAAAGTCTTGTTG
- 3′ sequencing primer CAACAAGACTTTTAAAACTCAACCC (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
OA984 was a gift from Omar Akbari (Addgene plasmid # 120363 ; http://n2t.net/addgene:120363 ; RRID:Addgene_120363) -
For your References section:
Broad dengue neutralization in mosquitoes expressing an engineered antibody. Buchman A, Gamez S, Li M, Antoshechkin I, Li HH, Wang HW, Chen CH, Klein MJ, Duchemin JB, Crowe JE Jr, Paradkar PN, Akbari OS. PLoS Pathog. 2020 Jan 16;16(1):e1008103. doi: 10.1371/journal.ppat.1008103. eCollection 2020 Jan. 10.1371/journal.ppat.1008103 PubMed 31945137