pMA_Level 2Γ
(Plasmid
#102707)
-
PurposeMobius Assembly Level 2 Acceptor Vector Γ
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 102707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepSB1C3
-
Backbone manufacturerBioBricks Foundation
- Backbone size w/o insert (bp) 2039
- Total vector size (bp) 2980
-
Vector typeSynthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameJ23106:B0034:sfGFP:rrnBT1-T7TE
-
Insert Size (bp)941
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site PstI (not destroyed)
- 5′ sequencing primer tgccacctgacgtctaagaa
- 3′ sequencing primer attaccgcctttgagtgagc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMA_Level 2Γ was a gift from Naomi Nakayama (Addgene plasmid # 102707 ; http://n2t.net/addgene:102707 ; RRID:Addgene_102707) -
For your References section:
Mobius Assembly: A versatile Golden-Gate framework towards universal DNA assembly. Andreou AI, Nakayama N. PLoS One. 2018 Jan 2;13(1):e0189892. doi: 10.1371/journal.pone.0189892. eCollection 2018. 10.1371/journal.pone.0189892 PubMed 29293531