His-MBP-NRBF2
(Plasmid
#99330)
-
PurposeMammalian expression of NRBF2, which associates with the PI3KC3-C1 complex
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 99330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbone1M
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameNuclear receptor-binding factor 2
-
Alt nameNRBF2
-
SpeciesH. sapiens (human)
-
GenBank IDNP_110386.2
-
Entrez GeneNRBF2 (a.k.a. COPR, COPR1, COPR2, NRBF-2)
- Promoter T7
-
Tag
/ Fusion Protein
- His-MBP (N terminal on backbone)
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer MBP_1010F: 5�- ccgctttctggtatgccgtgcg
- 3′ sequencing primer T7-Term (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid contains His-MBP-TEVsite-full NRBF2.
IMPORT NOTES: Special character found in field(5-prime Sequencing Primer)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
His-MBP-NRBF2 was a gift from James Hurley (Addgene plasmid # 99330 ; http://n2t.net/addgene:99330 ; RRID:Addgene_99330) -
For your References section:
Dynamics and architecture of the NRBF2-containing phosphatidylinositol 3-kinase complex I of autophagy. Young LN, Cho K, Lawrence R, Zoncu R, Hurley JH. Proc Natl Acad Sci U S A. 2016 Jul 19;113(29):8224-9. doi: 10.1073/pnas.1603650113. Epub 2016 Jul 6. 10.1073/pnas.1603650113 PubMed 27385829