lentiGuide-SYNJ2BP-2
(Plasmid
#92160)
-
PurposeCRISPR guide RNA targeting human SYNJ2BP
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92160 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonelentiGuide-Puro
-
Backbone manufacturerFeng Zhang Lab
- Backbone size w/o insert (bp) 8302
- Total vector size (bp) 8322
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSYNJ2BP sgRNA-2
-
gRNA/shRNA sequenceGTAAAACATGAACGGAAGAG
-
SpeciesH. sapiens (human)
- Promoter hU6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BsmBI (destroyed during cloning)
- 3′ cloning site BsmBI (destroyed during cloning)
- 5′ sequencing primer hU6-F (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
lentiGuide-SYNJ2BP-2 was a gift from Alice Ting (Addgene plasmid # 92160 ; http://n2t.net/addgene:92160 ; RRID:Addgene_92160) -
For your References section:
Proteomic mapping of cytosol-facing outer mitochondrial and ER membranes in living human cells by proximity biotinylation. Hung V, Lam SS, Udeshi ND, Svinkina T, Guzman G, Mootha VK, Carr SA, Ting AY. Elife. 2017 Apr 25;6. pii: e24463. doi: 10.7554/eLife.24463. 10.7554/eLife.24463 PubMed 28441135