-
PurposeExpresses c-Myc in mammalian cells
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 92046 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepT3-EF1a
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameC-MYC
-
Alt nameMYC
-
SpeciesH. sapiens (human)
-
GenBank IDP01106.1
-
Entrez GeneMYC (a.k.a. MRTL, MYCC, bHLHe39, c-Myc)
- Promoter EF-1a
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GAGTTTGGATCTTGGTTCATTC
- 3′ sequencing primer TAGAAGGCACAGTCGAGG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is in the OPEN state: there is no stop codon on c-myc.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
c-myc-PT3EF1a was a gift from Xin Chen (Addgene plasmid # 92046 ; http://n2t.net/addgene:92046 ; RRID:Addgene_92046) -
For your References section:
A functional mTORC1 signaling is indispensable for c-Myc driven hepatocarcinogenesis. Liu P, Ge M, Hu J, Li X, Che L, Sun K, Cheng L, Huang Y, Pilo MG, Cigliano A, Pes GM, Pascale RM, Brozzetti S, Vidili G, Porcu A, Cossu A, Palmieri G, Sini MC, Ribback S, Dombrowski F, Tao J, Calvisi DF, Chen L, Chen X. Hepatology. 2017 Mar 30. doi: 10.1002/hep.29183. 10.1002/hep.29183 PubMed 28370287