-
PurposeDonor template for generation of SOX2-ntdTomato reporter cell lines
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89991 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2657
- Total vector size (bp) 6324
-
Vector typeCRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSOX2-T2A-2xNLS-TdTomato-F2A-Puro
-
SpeciesH. sapiens (human)
-
Insert Size (bp)3667
-
Entrez GeneSOX2 (a.k.a. ANOP3, MCOPS3)
- Promoter none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer M13-fwd tgtaaaacgacggccagt
- 3′ sequencing primer M13-rv caggaaacagctatgaccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byTdTomato sequence was cloned from pCSCMV:tdTomato (a gift from Gerhart Ryffel, Addgene plasmid #30530).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC19-SOX2-T2A-2xNLS-tdTomato-F2A-Puro was a gift from Timo Otonkoski (Addgene plasmid # 89991 ; http://n2t.net/addgene:89991 ; RRID:Addgene_89991) -
For your References section:
Generation of a SOX2 reporter human induced pluripotent stem cell line using CRISPR/SaCas9. Balboa D, Weltner J, Novik Y, Eurola S, Wartiovaara K, Otonkoski T. Stem Cell Res. 2017 Jul;22:16-19. doi: 10.1016/j.scr.2017.05.005. Epub 2017 May 17. 10.1016/j.scr.2017.05.005 PubMed 28952927