pcDNA3.1+(rInsp)-Ins-GLuc
(Plasmid
#89928)
-
PurposeExpresses Insulin-GLuc from the rat insulin promoter. Gaussia Luc is inserted within the C-peptide and is co-secreted with insulin.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 89928 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3.1+rInsp
-
Backbone manufacturerInvitrogen (CMV removed)
- Backbone size w/o insert (bp) 5091
- Total vector size (bp) 5965
-
Modifications to backboneCMV promoter was excised using MluI/NheI digest and rat Insulin II promoter was inserted at the same sites.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman insulin-Gaussia-Luciferase
-
Alt namehIns-GLuc
-
SpeciesH. sapiens (human), Synthetic
-
Insert Size (bp)849
-
MutationDNA sequence for Gaussia luciferase was humanized and two mutations (M43I/M110I) were made to enhance glow-like kinetics.
-
Entrez GeneINS (a.k.a. IDDM, IDDM1, IDDM2, ILPR, IRDN, MODY10, PNDM4)
- Promoter rat Insulin II promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GTCGACGGATCGGGAGAT
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGeneArt Gene Synthesis (Life Technologies) was used to assemble human insulin with humanized Gaussia luciferase inserted into the C-peptide.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3.1+(rInsp)-Ins-GLuc was a gift from Melanie Cobb (Addgene plasmid # 89928 ; http://n2t.net/addgene:89928 ; RRID:Addgene_89928) -
For your References section:
Insulin promoter-driven Gaussia luciferase-based insulin secretion biosensor assay for discovery of beta-cell glucose-sensing pathways. Kalwat MA, Wichaidit C, Nava Garcia AY, McCoy MK, McGlynn K, Hwang IH, MacMillan JB, Posner BA, Cobb MH. ACS Sens. 2016 Oct 28;1(10):1208-1212. Epub 2016 Oct 12. 10.1021/acssensors.6b00433 PubMed 27819058