Skip to main content
Addgene

GFP-Rab27A
(Plasmid #89237)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 89237 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    peGFP-C1
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Total vector size (bp) 5360
  • Vector type
    Mammalian Expression
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    human Rab27A
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    660
  • Mutation
    wild type
  • GenBank ID
    BC132800.1
  • Entrez Gene
    RAB7A (a.k.a. CMT2B, PRO2706, RAB7)
  • Promoter CMV
  • Tag / Fusion Protein
    • eGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5’: CATGGTCCTGCTGGAGTTCGTGACCG
  • 3′ sequencing primer 5’: ATAAGCTGCAATAAACAAGTTAACAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    GFP-Rab27A was a gift from William Gahl (Addgene plasmid # 89237 ; http://n2t.net/addgene:89237 ; RRID:Addgene_89237)
  • For your References section:

    A novel missense mutation (G43S) in the switch I region of Rab27A causing Griscelli syndrome. Westbroek W, Tuchman M, Tinloy B, De Wever O, Vilboux T, Hertz JM, Hasle H, Heilmann C, Helip-Wooley A, Kleta R, Gahl WA. Mol Genet Metab. 2008 Jun;94(2):248-54. doi: 10.1016/j.ymgme.2008.02.009. Epub 2008 Apr 7. 10.1016/j.ymgme.2008.02.009 PubMed 18397837