Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX4T-Mst1 SARAH
(Plasmid #84297)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 84297 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-4T
  • Backbone manufacturer
    GE Healthcare
  • Backbone size w/o insert (bp) 4969
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Mst1
  • Alt name
    Stk4
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    162
  • Entrez Gene
    STK4 (a.k.a. KRS2, MST1, YSK3)
  • Promoter tac
  • Tag / Fusion Protein
    • GST (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer 5'd[GGGCTGGCAAGCCACGTTTGGTG]3'
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

To produce SARAH domain for interaction studies

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX4T-Mst1 SARAH was a gift from Jonathan Chernoff (Addgene plasmid # 84297 ; http://n2t.net/addgene:84297 ; RRID:Addgene_84297)
  • For your References section:

    H-ras Inhibits the Hippo Pathway by Promoting Mst1/Mst2 Heterodimerization. Rawat SJ, Araiza-Olivera D, Arias-Romero LE, Villamar-Cruz O, Prudnikova TY, Roder H, Chernoff J. Curr Biol. 2016 Jun 20;26(12):1556-63. doi: 10.1016/j.cub.2016.04.027. Epub 2016 May 26. 10.1016/j.cub.2016.04.027 PubMed 27238285