LeGO-lnc
(Plasmid #80624)

• Purpose: Lentiviral lncRNA Overexpression
• Depositing Lab: Jan-Henning Klusmann
• Publication: Emmrich et al Mol Cancer. 2014 Jul 15;13:171. doi: 10.1186/1476-4598-13-171.

Backbone

• Vector backbone: LeGO-Cer
• Backbone manufacturer: Kristoffer Ricken, Boris Fehse
• Backbone size w/o insert (bp): 8300
• Total vector size (bp): 8300
• Modifications to backbone: delete mU6 promoter, insert cloning oligo with lncRNA MCS (PacI, SgsI), insert BGHpolyA, insert PGK promoter
• Vector type: Lentiviral
• Selectable markers: Blasticidin ; mCerulean

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: empty control
• Promoter: SFFV

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: SgsI (unknown if destroyed)
• 3′ cloning site: PacI (unknown if destroyed)
• 5′ sequencing primer: GAGCTCACAACCCCTCACTC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The LeGO­lnc is a derivative of the LeGO-Cer/BSD, generated by Weber et al and as indicated for the LeGO-Cer (https://www.addgene.org/27351). Patents and licensing are also as indicated for LeGO-Cer (https://www.addgene.org/27351). The PGK-promoter was cloned from the MSCV-puro vector (Clonetech/Takara Bio).
• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The LeGO-Cer/BSD backbone was cut with XbaI and XhoI to remove the mouse U6 promoter. The linearized plasmid was blunted by a proof-read Polymerase and religated. The resulting LeGO-Cer-noU6 was cut with BamHI and the mouse phosphoglycerate kinase 1 promoter (PGK) -amplified from the MSCV-puro vector (Clonetech/Takara Bio) - was inserted in sense orientation to drive expression of the Cerulean-BSD cassette. An SV40 consensus polyadenylation signal (pA) with a PacI and a PstI site at the 3' end was gene synthesized and inserted into the NsiI site before the PGK promoter. The SFFV promoter from the LeGO-Cer backbone was removed by excision with NotI and PacI and a cloning oligo with an MCS for lncRNA insertion (5'-NotI->AanI->XmaJI->XhoI->XbaI->HpaI->PacI-3') was inserted with NotI and PacI. The SFFV fragment -amplified from LeGO-Cer- was reinserted into the NotI site to drive expression of the lnRNA-pA cassette.