pBAV150
(Plasmid
#79764)
-
Purpose(Empty Backbone) binary DEST vector for plant expression
-
Depositing Labs
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79764 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneBinary vector pTA7001
-
Modifications to backbonecombination of pTA7001 with EGFP
-
Vector typePlant Expression ; TetR
- Promoter DEX
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberLow Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer GCAATAATGGTTTCTGACGTATG
- 3′ sequencing primer CCCAGTCACGACGTTGTAAAACG (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byBoris Vinatzer, Jean Greenberg
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAV150 was a gift from Nico Dissmeyer & Jean Greenberg (Addgene plasmid # 79764 ; http://n2t.net/addgene:79764 ; RRID:Addgene_79764) -
For your References section:
The type III effector repertoire of Pseudomonas syringae pv. syringae B728a and its role in survival and disease on host and non-host plants. Vinatzer BA, Teitzel GM, Lee MW, Jelenska J, Hotton S, Fairfax K, Jenrette J, Greenberg JT. Mol Microbiol. 2006 Oct;62(1):26-44. Epub 2006 Aug 30. 10.1111/j.1365-2958.2006.05350.x PubMed 16942603