-
PurposeExpresses human codon-optimized LbCpf1 and Lb crRNA.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 74042 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepcDNA3.1
- Backbone size w/o insert (bp) 4642
- Total vector size (bp) 9441
-
Vector typeMammalian Expression, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameLb crRNA
-
Alt nameLachnospiraceae bacterium CRISPR RNA
-
Insert Size (bp)48
- Promoter human U6
Cloning Information for Gene/Insert 1
- Cloning method Unknown
- 5′ sequencing primer AAAACAGGAAGGCAAAATGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameLbCpf1
-
Alt nameLachnospiraceae bacterium Cpf1 nuclease
-
Alt nameLbCas12a
-
Insert Size (bp)3684
- Promoter CMV
-
Tags
/ Fusion Proteins
- NLS (C terminal on insert)
- 3xHA (C terminal on insert)
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTE4398 was a gift from Ervin Welker (Addgene plasmid # 74042 ; http://n2t.net/addgene:74042 ; RRID:Addgene_74042) -
For your References section:
Cpf1 nucleases demonstrate robust activity to induce DNA modification by exploiting homology directed repair pathways in mammalian cells. Toth E, Weinhardt N, Bencsura P, Huszar K, Kulcsar PI, Talas A, Fodor E, Welker E. Biol Direct. 2016 Sep 14;11:46. doi: 10.1186/s13062-016-0147-0. 10.1186/s13062-016-0147-0 [pii] PubMed 27630115