pSG5-FLAG-mEKLF Zinc Fingers
(Plasmid
#67837)
-
PurposeExpression of murine EKLF Zinc Fingers (aa 287-end) fused to Flag and driven by SV40 promoter
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 67837 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepSG5
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 4076
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEKLF
-
SpeciesM. musculus (mouse)
-
MutationZinc Fingers are amino acids 287-end; this numbering is based on amino acid 19 as the initiator Methionine; See depositor comments below on mutations G299S, T305S
-
Entrez GeneKlf1 (a.k.a. Eklf, Nan)
- Promoter SV40
-
Tag
/ Fusion Protein
- Flag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site StuI (unknown if destroyed)
- 3′ cloning site BamHI (unknown if destroyed)
- 5′ sequencing primer SV40pro-F2 (CCCCATGGCTGACTAATTTTT)
- 3′ sequencing primer SV40 poly A Reverse (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutations G299S, T305S have no functional consequences.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSG5-FLAG-mEKLF Zinc Fingers was a gift from James Bieker (Addgene plasmid # 67837 ; http://n2t.net/addgene:67837 ; RRID:Addgene_67837) -
For your References section:
Unanticipated repression function linked to erythroid Kruppel-like factor. Chen X, Bieker JJ. Mol Cell Biol. 2001 May;21(9):3118-25. 10.1128/MCB.21.9.3118-3125.2001 PubMed 11287616