-
PurposeExpression of HA tagged ADAM17 lacking prodomain and metalloprotease domain in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 65221 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepcDNA3
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 5446
- Total vector size (bp) 6546
-
Modifications to backbonein-frame HA tag between ApaI and XhoI sites of pcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameDelta(Pro-MP)ADAM17
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1100
-
Mutationdeleted AA 18-473
-
GenBank IDNM_003183
-
Entrez GeneADAM17 (a.k.a. ADAM18, CD156B, CSVP, NISBD, NISBD1, TACE)
- Promoter CMV
-
Tag
/ Fusion Protein
- HA (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CACTGCTTACTGGCTTATCG
- 3′ sequencing primer TGGCAACTAGAAGGCACAG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mutagenesis creates EcoRV site 57bp downstream of Start ATG.
Insert contains several point mutations compared to NM_003183 (see sequence).
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcDNA3-Delta(Pro-MP)ADAM17-HA was a gift from Axel Ullrich (Addgene plasmid # 65221 ; http://n2t.net/addgene:65221 ; RRID:Addgene_65221) -
For your References section:
TACE cleavage of proamphiregulin regulates GPCR-induced proliferation and motility of cancer cells. Gschwind A, Hart S, Fischer OM, Ullrich A. EMBO J. 2003 May 15;22(10):2411-21. 10.1093/emboj/cdg231 PubMed 12743035