Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pMCS-rybozyme-IRES-CAS9
(Plasmid #64668)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 64668 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 2988
  • Total vector size (bp) 8235
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    CAS9
  • Species
    Synthetic
  • Insert Size (bp)
    4188
  • Tags / Fusion Proteins
    • Internal ribosome entry site (N terminal on backbone)
    • Flag (N terminal on insert)

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer GAAGCCGCTTGGAATAAGGC
  • 3′ sequencing primer ATTTTTGGCAGAGGGAAAAAG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    HDV ribozyme
  • Species
    Hepatitis delta virus
  • Insert Size (bp)
    68
  • Tag / Fusion Protein
    • guide RNA scahold sequence (N terminal on insert)

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer GCACATTTCCCCGAAAAGTG
  • 3′ sequencing primer GGCTTCGGCCAGTAACGTTAG
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The human codon-optimized hCas9 insert in this vector was amplified from plasmid hCas9 (George Church; Addgene #41815).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMCS-rybozyme-IRES-CAS9 was a gift from Wataru Fujii (Addgene plasmid # 64668 ; http://n2t.net/addgene:64668 ; RRID:Addgene_64668)
  • For your References section:

    Development of a mono-promoter-driven CRISPR/Cas9 system in mammalian cells. Yoshioka S, Fujii W, Ogawa T, Sugiura K, Naito K. Sci Rep. 2015 Dec 16;5:18341. doi: 10.1038/srep18341. 10.1038/srep18341 PubMed 26669567