Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

lenti sgRNA(MS2)_zeo backbone
(Plasmid #61427)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61427 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Cloning Grade DNA 61427-DNA.cg 2 µg of cloning grade DNA in Tris buffer 1 $105

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    plenti
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Promoter U6 and EF1A
  • Selectable markers
    Zeocin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    none
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GAG GGC CTA TTT CCC ATG ATT CCT TCA TAT
  • 3′ sequencing primer cctagaaggtccattagctgcaaagattcc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For additional information, protocols and an activator sgRNA design tool, visit our website:
http://sam.genome-engineering.org/

Information for Cloning Grade DNA (Catalog # 61427-DNA.cg) ( Back to top)

Purpose

Cloning grade DNA is suitable for use in PCR, cloning reactions, or transformation into E. coli. The purity and amount is not suitable for direct transfections.

Delivery

  • Amount 2 µg
  • Guaranteed Concentration 100 ng/µl +/- 5 ng/µl
  • Pricing $105 USD
  • Storage DNA can be stored at 4℃ (short term) or -20℃ (long term).

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Quality Control

Addgene has verified this plasmid using Next Generation Sequencing. Results are available here

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    lenti sgRNA(MS2)_zeo backbone was a gift from Feng Zhang (Addgene plasmid # 61427 ; http://n2t.net/addgene:61427 ; RRID:Addgene_61427)
  • For your References section:

    Genome-scale transcriptional activation by an engineered CRISPR-Cas9 complex. Konermann S, Brigham MD, Trevino AE, Joung J, Abudayyeh OO, Barcena C, Hsu PD, Habib N, Gootenberg JS, Nishimasu H, Nureki O, Zhang F. Nature. 2014 Dec 10. doi: 10.1038/nature14136. 10.1038/nature14136 PubMed 25494202