Skip to main content
Addgene

pHR-SFFV-KRAB-dCas9-P2A-mCherry
(Plasmid #60954)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60954 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHR
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 9000
  • Total vector size (bp) 14247
  • Vector type
    Mammalian Expression, Lentiviral, CRISPR
  • Selectable markers
    mCherry

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    KRAB-dCas9-P2A-mCherry fusion
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    5244
  • Promoter SFFV
  • Tags / Fusion Proteins
    • KRAB domain (N terminal on insert)
    • HA (C terminal on insert)
    • 2x NLS (C terminal on insert)
    • mCherry

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gcttcccgagctctataaaagag
  • 3′ sequencing primer CCAGAGGTTGATTATCGATAAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
  • Articles Citing this Plasmid

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that this plasmid contains a different promoter compared to the inducible KRAB-dCas9-P2A-mCherry construct described in Figure 5A of the associated publication (Gilbert et al., 2014). To create an inducible version of KRAB-dCas9-P2A-mCherry, subclone the insert into a backbone with an inducible promoter, such as pTRE3G.

For stable expression of KRAB-dCas9 as described in Gilbert et al., 2014, please see pHR-SFFV-dCas9-BFP-KRAB (Addgene plasmid #46911).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHR-SFFV-KRAB-dCas9-P2A-mCherry was a gift from Jonathan Weissman (Addgene plasmid # 60954 ; http://n2t.net/addgene:60954 ; RRID:Addgene_60954)
  • For your References section:

    Genome-Scale CRISPR-Mediated Control of Gene Repression and Activation. Gilbert LA, Horlbeck MA, Adamson B, Villalta JE, Chen Y, Whitehead EH, Guimaraes C, Panning B, Ploegh HL, Bassik MC, Qi LS, Kampmann M, Weissman JS. Cell. 2014 Oct 23;159(3):647-61. doi: 10.1016/j.cell.2014.09.029. Epub 2014 Oct 9. 10.1016/j.cell.2014.09.029 PubMed 25307932