-
PurposeCombination adh1:cas9/rrk1:sgRNA for CRISPR genome editing in fission yeast: Empty sgRNA target (CspCI placeholder) (see comments).
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59896 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMZ283
- Backbone size w/o insert (bp) 6215
- Total vector size (bp) 10640
-
Vector typeYeast Expression, CRISPR
-
Selectable markersura4
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameCas9
-
MutationSilent muation of the CspCI site
- Promoter adh1
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTCAGCCCGAGTGACAGG
- 3′ sequencing primer TGGAGAAAGGGAAGTCTAAAAA (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namerrk1:sgRNA
- Promoter rrk1
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer M13F
- 3′ sequencing primer M13R (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Please note that some batches of CspCI from New England Biolabs may cut inefficiently and alters the mobility of the DNA, possibly because it remains bound to the target. The two batches that are known to work are 0041303 and 0051407. This may be due to the particular target sequence present in pMZ283 and pMZ374.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMZ374 was a gift from Mikel Zaratiegui (Addgene plasmid # 59896 ; http://n2t.net/addgene:59896 ; RRID:Addgene_59896) -
For your References section:
Implementation of the CRISPR-Cas9 system in fission yeast. Jacobs JZ, Ciccaglione KM, Tournier V, Zaratiegui M. Nat Commun. 2014 Oct 29;5:5344. doi: 10.1038/ncomms6344. 10.1038/ncomms6344 PubMed 25352017