pMiR-E6AP-3'UTR-miR-375-mut
(Plasmid
#53695)
-
PurposeLuciferase reporter assay for E6AP 3'UTR with point mutation on miR-375 binding site
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53695 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMiR-Target
-
Backbone manufacturerOrigene
- Backbone size w/o insert (bp) 7900
- Total vector size (bp) 9800
-
Vector typeLuciferase
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameUBE3A 3'UTR
-
Alt nameE6AP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1896
-
MutationMutation on miR-375 binding site on E6AP 3'UTR (refer to citation)
-
GenBank IDNM_000462.3
-
Entrez GeneUBE3A (a.k.a. ANCR, AS, E6-AP, EPVE6AP, HPVE6A, PIX1)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site Not1 (not destroyed)
- 5′ sequencing primer AGAAGCTGCGCGGTGGTGTTGTG
- 3′ sequencing primer CTGGAGGATCATCCAGCCGGCGT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMiR-E6AP-3'UTR-miR-375-mut was a gift from Edward Chan (Addgene plasmid # 53695 ; http://n2t.net/addgene:53695 ; RRID:Addgene_53695) -
For your References section:
miR-375 activates p21 and suppresses telomerase activity by coordinately regulating HPV E6/E7, E6AP, CIP2A, and 14-3-3zeta. Jung HM, Phillips BL, Chan EK. Mol Cancer. 2014 Apr 8;13(1):80. doi: 10.1186/1476-4598-13-80. 10.1186/1476-4598-13-80 PubMed 24708873
Map uploaded by the depositor.