-
Purposelentiviral U6 driven sgRNA cloning vector where guide sequences are inserted between BfuAI sites, improved cassette cloning efficiency
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52628 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7145
- Total vector size (bp) 8195
-
Vector typeMammalian Expression, Lentiviral, CRISPR
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin and Kanamycin, 100 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameKanamycin cassette
-
SpeciesBacterial origin
-
Insert Size (bp)1050
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CGTGACGTAGAAAGTAATAATTTC
- 3′ sequencing primer CCTCGAGCCGCGGCCAAAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This is a second generation plasmid that increases the efficiency of sgRNA guide cloning over the original "pLKO.1-puro U6 sgRNA BspMI stuffer" vector.
"pLKO.1-puro U6 sgRNA BfuAI large stuffer" was created to simplify the cloning of the sgRNA guide cassette into pLKO.1-puro U6 sgRNA BspMI stuffer vector originally described in the manuscript “Kearns, NA, etal. Development 2014, 141(1):219-23”. The original vector has a small intervening sequence that presents two problems: 1) the efficiency of excision by BfuAI is moderate, and 2) the size of this spacer is similar to the guide sequence, which makes distinguishing positive clones from reclosures challenging. Consequently, we have inserted a Kanamycin cassette between these sites at a unique Bcl1 site. This element is more efficiently excised by BfuAI and makes distinguishing vectors containing the desired guide sequence easy to distinguish from the parent vector. The excision of the Kan cassette by BfuAI cuts this cassette into 3 fragments due to two internal BfuAI sites within the Kan cassette. Otherwise the cloning of the guides is carried out as described in the manuscript.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1-puro U6 sgRNA BfuAI large stuffer was a gift from Scot Wolfe (Addgene plasmid # 52628 ; http://n2t.net/addgene:52628 ; RRID:Addgene_52628)