pC5Kan-P2A
(Plasmid #51814)

• Purpose: P2A peptide from porcine teschovirus-1 flanked by restriction sites in shuttle vector for easy cloning of multiple separate proteins to be expressed from single message
• Depositing Lab: Barry Ganetzky
• Publication: Daniels et al PLoS One. 2014 Jun 19;9(6):e100637. doi: 10.1371/journal.pone.0100637. eCollection 2014.

Backbone

• Vector backbone: pC5-Kan_delta_SphI
• Backbone manufacturer: EF090405
• Backbone size w/o insert (bp): 2619
• Total vector size (bp): 2685
• Modifications to backbone: P2A peptide coding sequence inserted in middle of MCS of pC5-Kan shuttle vector for easy transfer into C5-series Drosophila expression vectors.
• Vector type: shuttle vector for insect expression vectors

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: P2A peptide
• Alt name: 2A peptide from porcine teschovirus-1
• Species: Synthetic; porcine teschovirus-1
• Insert Size (bp): 66
• Mutation: codons altered for Drosophila and to eliminate restriction sites
• GenBank ID: NP_740353
• Entrez Gene: PTV1gp1 (a.k.a. PTV1gp1)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (destroyed during cloning)
• 3′ cloning site: BglII (not destroyed)
• 5′ sequencing primer: AAGCAGCAGATTACGCGCAG
• 3′ sequencing primer: GCCATCACGAGATTTCGATTCC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Useful for cloning two proteins for bicistronic expression. Proteins undergo an efficient co-translational separation event due to the presence of the 2A peptide sequence derived from porcine teschovirus-1.