-
PurposeEncodes a template from which gRNAs can be made via InFusion cloning. The Medicago truncatula U6.6 promoter drives the gRNA. For use in plants.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 47024 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
- Backbone size w/o insert (bp) 2691
- Total vector size (bp) 3142
-
Modifications to backboneThe original pUC19 MCS modified to include I-PpoI recognition site. Some restriction sites removed.
-
Vector typePlant Expression, CRISPR ; Cas9
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA Shuttle
-
SpeciesSynthetic; Medicago truncatula
-
Insert Size (bp)465
-
MutationG to T cloning mutation at position 323
- Promoter Medicago truncatula U6.6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site I-PpoI (not destroyed)
- 3′ cloning site I-PpoI (not destroyed)
- 5′ sequencing primer AGCGGATAACAATTTCACACAGGA
- 3′ sequencing primer GTAAAACGACGGCCAGT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe insert was originally synthesized by IDT via gBlocks.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUC gRNA Shuttle was a gift from Wayne Parrott (Addgene plasmid # 47024 ; http://n2t.net/addgene:47024 ; RRID:Addgene_47024) -
For your References section:
Targeted genome modifications in soybean with CRISPR/Cas9. Jacobs TB, LaFayette PR, Schmitz RJ, Parrott WA. BMC Biotechnol. 2015 Mar 12;15:16. doi: 10.1186/s12896-015-0131-2. 10.1186/s12896-015-0131-2 PubMed 25879861