pHR-SFFV-dCas9-BFP
(Plasmid #46910)

• Purpose: Human expression vector containing SFFV promoter, dCas9 that is fused to 2x NLS and tagBFP
• Depositing Labs: Stanley Qi, Jonathan Weissman
• Publication: Gilbert et al Cell. 2013 Jul 9. pii: S0092-8674(13)00826-X. doi: 10.1016/j.cell.2013.06.044.

Backbone

• Vector backbone: pHR
• Backbone manufacturer: Addgene
• Backbone size w/o insert (bp): 9000
• Total vector size (bp): 13936
• Vector type: Mammalian Expression, Lentiviral, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: dCas9-BFP fusion
• Species: H. sapiens (human)
• Insert Size (bp): 4935
• Promoter: SFFV
• Tags / Fusion Proteins:
  • HA (C terminal on insert)
  • 2xNLS (C terminal on insert)
  • BFP (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: gcttcccgagctctataaaagag
• 3′ sequencing primer: CCAGAGGTTGATTATCGATAAGC

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The Cas9 gene was a gift from Martin Jinek and Jennifer Doudna
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry