AmCyan-P2A-mCherry
(Plasmid #45350)

• Depositing Lab: Ilpo Huhtaniemi
• Publication: Potorac et al J Endocrinol. 2016 Sep 21. pii: JOE-16-0384.

Backbone

• Vector backbone: pmR-mCherry
• Backbone manufacturer: Clontech
• Backbone size w/o insert (bp): 4729
• Total vector size (bp): 5607
• Vector type: Mammalian Expression
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: AmCyan
• Alt name: AmCyan1 fluorescent protein
• Alt name: nAmCyan nuclear localization
• Species: Synthetic
• Insert Size (bp): 890
• Mutation: SV40 NLS
• Promoter: CMV
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: CGTGTACGGTGGGAGGTCTA
• 3′ sequencing primer: GGTACCGTCGACTGCAGAAT

Resource Information

• Supplemental Documents:
  • AmCyan-P2A-mCherry
• A portion of this plasmid was derived from a plasmid made by: The nAmCyan gene is also from Clontech but was cloned from Plasmid 29756: pAd/WT1-IRES-nAmCyan by recombineering
• Articles Citing this Plasmid:
  • 7 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry

Depositor Comments

the nAmCyan and the mCherry genes are separated by a P2A sequence that results in 2 separate proteins. It also includes BsmBI restriction sites flanking the nAmCyan gene which result in BsiWI and BssHII overhangs for cloning in-frame with P2A-mCherry.