Skip to main content
Addgene

pHEX2 T494 TALENs
(Plasmid #44464)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 44464 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pHEX2
  • Backbone size w/o insert (bp) 13812
  • Total vector size (bp) 21391
  • Vector type
    Plant Transformation
  • Selectable markers
    Kanamycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    AtCRU3 T494 TALENs
  • Alt name
    Arabidopsis thaliana CRUCIFERIN 3 gene Target 494 TALENs
  • Species
    Synthetic
  • Insert Size (bp)
    7549
  • Promoter CaMV 35S

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer RAJ-417 (CAACCACGTCTTCAAAGCAAGTG)
  • 3′ sequencing primer m13 Forward
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The gene was custom-made, but includes sequence from pZHY013 from Zhang et al. 2012
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

pZHY013 reference:
Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF (2012) TALENs enable efficient plant genome engineering. Plant Physiology. doi:10.1104/pp.112.205179

Please refer to the references provided below for matters relating to ownership of pHEX2 for anything other than academic use.

pHEX2 reference:
Hellens R, Allan A, Friel E, Bolitho K, Grafton K, Templeton M, Karunairetnam S, Gleave A, Laing W (2005) Transient expression vectors for functional genomics, quantification of promoter activity and RNA silencing in plants. Plant Methods 1 (1):13. doi:10.1186/1746-4811-1-13

pART27 (used to derive pHEX2) reference:
Gleave AP (1992) A versatile binary vector system with a T-DNA organisational structure conducive to efficient integration of cloned DNA into the plant genome. Plant Mol Biol 20:1203-1207

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pHEX2 T494 TALENs was a gift from Roger Hellens & Ross Johnson (Addgene plasmid # 44464 ; http://n2t.net/addgene:44464 ; RRID:Addgene_44464)