pRE107
(Plasmid #43829)

• Purpose: (Empty Backbone)
• Depositing Lab: Dieter Schifferli
• Publication: Edwards et al Gene. 1998 Jan 30;207(2):149-57.

Backbone

• Vector backbone: pGP704
• Backbone manufacturer: John Mekalanos lab, Harvard Medical School (PMID: 2836362)
• Backbone size (bp): 5720
• Modifications to backbone: SacB1 from pUC58-sacB1 cloned into the EcoRI site. BamHI site in oriV converted to a ClaI site by partial digestion and Klenow treatment.
• Vector type: Bacterial Expression ; Bacterial allelic exchange vector with sacB1
• Selectable markers: SacB (sucrose sensitivity)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): SM10 λpir
• Growth instructions: Contains lambda pir-dependent R6K replication origin; requires lambda pir-containing bacteria strain
• Copy number: Low Copy

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ sequencing primer: Amp-R (ATAATACCGCGCCACATAGC)

Resource Information

• Supplemental Documents:
  • pRE107 annotated Genbank file
• A portion of this plasmid was derived from a plasmid made by: SM10 λpir bacterial strain and pGP704 plasmid backbone from John Mekalanos, Harvard Medical School, Boston, MA. SacB1 gene from plasmid pUC58-sacBI from Dennis Ohman, VCU Medical Center, Richmond, VA.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The plasmids deposited here comprise a set of SacB1-dependent allelic exchange vectors improved from a previously described suicide vector, pGP704 (Miller and Mekalanos, 1988), by including a system to select for plasmid loss by recombination.

Plasmid pRE107 was constructed by cloning the appropriate EcoRI fragment from pUC58-sacB1 (McIver et al., 1995) into pGP704 (see associated schematic image). The sacB1 allele is a modified variation of sacB, where unique restriction sites were removed by site directed mutagenesis (McIver et al., 1995). Additionally, the BamHI site in the R6K ori of the resulting plasmid was removed by partial BamHI digestion, blunting the resulting overhangs with PolIk (resulting in the formation of a ClaI site) and screening for its loss by restriction analysis.

The resulting plasmid together with others in this deposited series contain the conditional R6K ori, the origin of transfer (oriT) which allows conjugative transfer from permissive hosts, the sacB1 gene to provide negative selection and a MCS, along with a range of different AbR markers.

Note: Addgene's NGS results found that a large portion of the plasmid backbone (containing the oriT feature) is in the opposite orientation compared to the depositor's reference sequence.