pZHY501
(Plasmid
#36187)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 36187 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCP4
- Total vector size (bp) 7498
-
Modifications to backboneGolden Gate compatible (see Cermak, et al., 2011) expression vector for TALENs. TAL-DNA binding domain can be removed via BamHI and XbaI digestion.
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameHomodimeric FokI Nuclease
-
Mutationdelta152,+63 truncation to TAL backbone
- Promoter TEV
-
Tag
/ Fusion Protein
- ACV5 (N terminal on backbone)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ttggcgtcggcaaacagtgg
- 3′ sequencing primer ttaaaagtttatctcaccg (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note that there are some minor discrepancies between the Addgene quality control sequence and the sequence from the depositor. These differences will not affect the function of the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZHY501 was a gift from Daniel Voytas (Addgene plasmid # 36187 ; http://n2t.net/addgene:36187 ; RRID:Addgene_36187) -
For your References section:
TALENs enable efficient plant genome engineering. Zhang Y, Zhang F, Li X, Baller JA, Qi Y, Starker CG, Bogdanove AJ, Voytas DF. Plant Physiol. 2012 Nov 2. 10.1104/pp.112.205179 PubMed 23124327