Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pWPI-FLAG-hPRKCI
(Plasmid #35387)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 35387 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pWPI
  • Backbone manufacturer
    Addgene
  • Backbone size w/o insert (bp) 11076
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Protein Kinase C iota
  • Alt name
    PRKCI
  • Alt name
    atypical Protein Kinase C
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1820
  • GenBank ID
    BAG70257.1
  • Entrez Gene
    PRKCI (a.k.a. DXS1179E, PKCI, nPKC-iota)
  • Tag / Fusion Protein
    • FLAG (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PmeI (destroyed during cloning)
  • 3′ cloning site PmeI (destroyed during cloning)
  • 5′ sequencing primer ACTGGAATCCACCATGGAAC
  • 3′ sequencing primer AAGAATGTGTCTGACAGCTG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note that the vector backbone, pWPI, is a bicistronic vector that allows for simultaneous expression of a transgene (PRKCI in this case) and an EGFP marker to facilitate tracking of transduced cells. The EGFP marker cDNA has been inserted downstream of EMCV IRES.

The PRKCI insert in this plasmid is a known variant that lack the first nine amino acids of PRKCI when compared to GenBank entry NP_002731.4

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWPI-FLAG-hPRKCI was a gift from Luke McCaffrey (Addgene plasmid # 35387 ; http://n2t.net/addgene:35387 ; RRID:Addgene_35387)