Skip to main content

pCMV(CAT)T7-SB100
(Plasmid #34879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 34879 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pCMV
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SB100X transposase
  • Insert Size (bp)
    1023
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SpeI (unknown if destroyed)
  • 3′ cloning site ApaI (unknown if destroyed)
  • 5′ sequencing primer CACCAAAATCAACGGGACTT
  • (Common Sequencing Primers)

Resource Information

  • Addgene Notes
  • A portion of this plasmid was derived from a plasmid made by
    Prof. Dr. Zsuzsanna Izsvak, Max-Delbrueck-Center for Molecular Medicine, Berlin

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The Sleeping Beauty transposon system consists of two components: the transposon vector and the transposase vector. The transposon vector (pT4/HB, Addgene #108352) contains binding sites flanking the GOI. And the transposase vector (pCMV(CAT)T7-SB100, Addgene #34879) encodes for the enzyme mediating excision and integration of the GOI.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCMV(CAT)T7-SB100 was a gift from Zsuzsanna Izsvak (Addgene plasmid # 34879)
  • For your References section:

    Molecular evolution of a novel hyperactive Sleeping Beauty transposase enables robust stable gene transfer in vertebrates. Mates L, Chuah MK, Belay E, Jerchow B, Manoj N, Acosta-Sanchez A, Grzela DP, Schmitt A, Becker K, Matrai J, Ma L, Samara-Kuko E, Gysemans C, Pryputniewicz D, Miskey C, Fletcher B, VandenDriessche T, Ivics Z, Izsvak Z. Nat Genet. 2009 Jun;41(6):753-61. Epub 2009 May 3. 10.1038/ng.343 PubMed 19412179