Skip to main content
Addgene

pEGFP-ATF6-(S1P-)
(Plasmid #32956)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 32956 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C3
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 4700
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ATF6
  • Species
    H. sapiens (human)
  • Mutation
    S1Protease site mutation: R415A/R416A
  • Entrez Gene
    ATF6 (a.k.a. ACHM7, ATF6A, ATP6alpha)
  • Promoter CMV
  • Tag / Fusion Protein
    • EGFP (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site SalI (not destroyed)
  • 5′ sequencing primer EGFP-C
  • 3′ sequencing primer hATF6-R (gaacccatcctcgaagttca)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

During sequencing a change of Methionine 67 to Leucine, and Methionine 313 to Isoleucine was detected. This change in the basic region should not affect experiments with this construct, but could affect DNA binding by derivatives made from this plasmid.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEGFP-ATF6-(S1P-) was a gift from Ron Prywes (Addgene plasmid # 32956 ; http://n2t.net/addgene:32956 ; RRID:Addgene_32956)
  • For your References section:

    The luminal domain of ATF6 senses endoplasmic reticulum (ER) stress and causes translocation of ATF6 from the ER to the Golgi. Chen X, Shen J, Prywes R. J Biol Chem. 2002 Apr 12. 277(15):13045-52. 10.1074/jbc.M110636200 PubMed 11821395