Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

SF-1 shRNA #1
(Plasmid #28186)

Full plasmid sequence is not available for this item.

Loading...

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 28186 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRNAT-CMV3.1/Neo
  • Backbone manufacturer
    Genscript
  • Backbone size w/o insert (bp) 6478
  • Vector type
    Mammalian Expression, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Nr5a1 shRNA
  • Alt name
    Nr5a1
  • Species
    M. musculus (mouse)
  • Entrez Gene
    Nr5a1 (a.k.a. Ad4BP, ELP, ELP-3, Ftz-F1, Ftzf1, SF-1, SF1, STF-1)
  • Tag / Fusion Protein
    • cGFP (C terminal on backbone)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

shRNA #1 sequence: GATCCTAATGCTTGTTGTTCTGGACTTTGATATCCGAGTCCAGAACAACAAGCATTACGC

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    SF-1 shRNA #1 was a gift from Bernard Schimmer (Addgene plasmid # 28186 ; http://n2t.net/addgene:28186 ; RRID:Addgene_28186)
  • For your References section:

    Contributions of specificity protein-1 and steroidogenic factor 1 to Adcy4 expression in Y1 mouse adrenal cells. Rui X, Tsao J, Scheys JO, Hammer GD, Schimmer BP. Endocrinology. 2008 Jul . 149(7):3668-78. 10.1210/en.2008-0203 PubMed 18388192